Skip to main content

pUPD2_SulR(CDS)
(Plasmid #186423)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186423 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUPD2
  • Backbone manufacturer
    GoldenBraid kit from Diego Orzaez (Addgene kit # 1000000076 ), IBMCP, Valencia, Spain
  • Backbone size w/o insert (bp) 2106
  • Total vector size (bp) 3117
  • Vector type
    Plant Expression, Synthetic Biology ; CDS (part B3-B4-B5), GoldenBraid level 0

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SulR
  • Alt name
    sulfadiazine resistance
  • Alt name
    sulI
  • Species
    A. thaliana (mustard weed), Synthetic
  • Insert Size (bp)
    1011
  • Mutation
    BsaI and BsmBI sites removed

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer pUDP2_F: GCTTTCGCTAAGGATGATTTCTGG
  • 3′ sequencing primer pUDP2_R: CAGGGTGGTGACACCTTGCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUPD2_SulR(CDS) was a gift from Lukas Fischer (Addgene plasmid # 186423 ; http://n2t.net/addgene:186423 ; RRID:Addgene_186423)
  • For your References section:

    Sulfadiazine and phosphinothricin selection systems optimised for the transformation of tobacco BY-2 cells. Kobercova E, Srba M, Fischer L. Plant Cell Rep. 2023 Jan 7. doi: 10.1007/s00299-022-02975-7. 10.1007/s00299-022-02975-7 PubMed 36609768