Skip to main content

pDGB1alpha2_KanR_BastaR_Rb7_GFP
(Plasmid #186427)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186427 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDGB1_alpha2 (Plasmid #68225)
  • Backbone manufacturer
    GoldenBraid 2.0 kit from Diego Orzaez (Addgene kit # 1000000076 ), IBMCP, Valencia, Spain
  • Backbone size w/o insert (bp) 2610
  • Total vector size (bp) 9412
  • Vector type
    Plant Expression, Synthetic Biology ; binary vector for Escherichia coli and Agrobacterium tumefaciens-mediated plant transformation

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    KanR
  • Alt name
    kanamycin resistance
  • Alt name
    neomycin phosphotransferase II with nopaline synthase promoter/terminator
  • Alt name
    nptII
  • Species
    A. thaliana (mustard weed), Synthetic
  • Insert Size (bp)
    1398
  • Mutation
    BsaI and BsmBI sites removed
  • Promoter Pnos

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer pDGB1_alpha_F: CAACCTCTCGGGCTTCTGGA
  • 3′ sequencing primer RB7-MAR-5: GGTTCGAATTTGTTTTACTC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    BastaR
  • Alt name
    bar gene for plant expression
  • Alt name
    phosphinothricin (bialaphos) resistance
  • Alt name
    phosphinothricin N-acetyltransferase
  • Species
    A. thaliana (mustard weed), Synthetic
  • Insert Size (bp)
    2021
  • Mutation
    BsaI and BsmBI sites removed
  • Promoter CaMV 35S

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer pDGB1_alpha_F: CAACCTCTCGGGCTTCTGGA
  • 3′ sequencing primer RB7-MAR-5: GGTTCGAATTTGTTTTACTC
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    Rb7
  • Alt name
    matrix attachment region Rb7 from N. tabacum
  • Alt name
    derived from pUPD1:Rb7-MAR (Plasmid #106212)
  • Species
    A. thaliana (mustard weed), Synthetic
  • Insert Size (bp)
    1166
  • Mutation
    BsaI and BsmBI sites removed

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer -
  • 3′ sequencing primer -
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    eGFP
  • Alt name
    green fluorescent protein
  • Alt name
    plant expression driven by the 35S promoter and enhanced by 5'UTR/3'UTR from Cowpea Mosaic Virus (CPMV) RNA-2
  • Species
    A. thaliana (mustard weed), Synthetic
  • Insert Size (bp)
    2217
  • Mutation
    BsaI and BsmBI sites removed
  • Promoter CaMV 35S

Cloning Information for Gene/Insert 4

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer RB7-MAR-3: AAAGAATGGCAGTTTTCCTT
  • 3′ sequencing primer pDGB1_alpha_R: GCGACTTAGTTTACCCGCCAA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    We combined four transcriptional units together. Originally, transcriptional units BastaR, Rb7 and eGFP were prepared by Tomáš Moravec ( IEB, Prague, Czech Republic); KanR comes from pEGB Tnos:NptII:Pnos (#68212, Addgene).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDGB1alpha2_KanR_BastaR_Rb7_GFP was a gift from Lukas Fischer (Addgene plasmid # 186427 ; http://n2t.net/addgene:186427 ; RRID:Addgene_186427)
  • For your References section:

    Sulfadiazine and phosphinothricin selection systems optimised for the transformation of tobacco BY-2 cells. Kobercova E, Srba M, Fischer L. Plant Cell Rep. 2023 Jan 7. doi: 10.1007/s00299-022-02975-7. 10.1007/s00299-022-02975-7 PubMed 36609768