pDGB1alpha2_KanR_BastaR_Rb7_GFP
(Plasmid
#186427)
-
Purposeoptimisation of phosphinothricin (Basta) selection in plant cells; combines kanamycin resistance gene (nptII) and Basta resistance gene (bar) with fluorescent marker (eGFP)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 186427 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDGB1_alpha2 (Plasmid #68225)
-
Backbone manufacturerGoldenBraid 2.0 kit from Diego Orzaez (Addgene kit # 1000000076 ), IBMCP, Valencia, Spain
- Backbone size w/o insert (bp) 2610
- Total vector size (bp) 9412
-
Vector typePlant Expression, Synthetic Biology ; binary vector for Escherichia coli and Agrobacterium tumefaciens-mediated plant transformation
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameKanR
-
Alt namekanamycin resistance
-
Alt nameneomycin phosphotransferase II with nopaline synthase promoter/terminator
-
Alt namenptII
-
SpeciesA. thaliana (mustard weed), Synthetic
-
Insert Size (bp)1398
-
MutationBsaI and BsmBI sites removed
- Promoter Pnos
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer pDGB1_alpha_F: CAACCTCTCGGGCTTCTGGA
- 3′ sequencing primer RB7-MAR-5: GGTTCGAATTTGTTTTACTC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameBastaR
-
Alt namebar gene for plant expression
-
Alt namephosphinothricin (bialaphos) resistance
-
Alt namephosphinothricin N-acetyltransferase
-
SpeciesA. thaliana (mustard weed), Synthetic
-
Insert Size (bp)2021
-
MutationBsaI and BsmBI sites removed
- Promoter CaMV 35S
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer pDGB1_alpha_F: CAACCTCTCGGGCTTCTGGA
- 3′ sequencing primer RB7-MAR-5: GGTTCGAATTTGTTTTACTC
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameRb7
-
Alt namematrix attachment region Rb7 from N. tabacum
-
Alt namederived from pUPD1:Rb7-MAR (Plasmid #106212)
-
SpeciesA. thaliana (mustard weed), Synthetic
-
Insert Size (bp)1166
-
MutationBsaI and BsmBI sites removed
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer -
- 3′ sequencing primer -
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameeGFP
-
Alt namegreen fluorescent protein
-
Alt nameplant expression driven by the 35S promoter and enhanced by 5'UTR/3'UTR from Cowpea Mosaic Virus (CPMV) RNA-2
-
SpeciesA. thaliana (mustard weed), Synthetic
-
Insert Size (bp)2217
-
MutationBsaI and BsmBI sites removed
- Promoter CaMV 35S
Cloning Information for Gene/Insert 4
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer RB7-MAR-3: AAAGAATGGCAGTTTTCCTT
- 3′ sequencing primer pDGB1_alpha_R: GCGACTTAGTTTACCCGCCAA
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byWe combined four transcriptional units together. Originally, transcriptional units BastaR, Rb7 and eGFP were prepared by Tomáš Moravec ( IEB, Prague, Czech Republic); KanR comes from pEGB Tnos:NptII:Pnos (#68212, Addgene).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDGB1alpha2_KanR_BastaR_Rb7_GFP was a gift from Lukas Fischer (Addgene plasmid # 186427 ; http://n2t.net/addgene:186427 ; RRID:Addgene_186427) -
For your References section:
Sulfadiazine and phosphinothricin selection systems optimised for the transformation of tobacco BY-2 cells. Kobercova E, Srba M, Fischer L. Plant Cell Rep. 2023 Jan 7. doi: 10.1007/s00299-022-02975-7. 10.1007/s00299-022-02975-7 PubMed 36609768