Tubulin-mhYFP
(Plasmid
#186525)
-
PurposeLocalization of monomeric hyperfolder YFP fluorescent protein to tubulin
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186525 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonen/a
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMonomeric hyperfolder YFP
-
Alt namemhYFP
-
SpeciesSynthetic
-
Insert Size (bp)717
-
MutationhfYFP-S147P/L195M/V206K
- Promoter CMV
-
Tag
/ Fusion Protein
- Tubulin (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BshTI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CMV Forward (CGCAAATGGGCGGTAGGCGTG)
- 3′ sequencing primer GACATGGACGAGCTGTACAAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Tubulin-mhYFP was a gift from Gregory Petsko (Addgene plasmid # 186525 ; http://n2t.net/addgene:186525 ; RRID:Addgene_186525) -
For your References section:
Chemically stable fluorescent proteins for advanced microscopy. Campbell BC, Paez-Segala MG, Looger LL, Petsko GA, Liu CF. Nat Methods. 2022 Nov 7. pii: 10.1038/s41592-022-01660-7. doi: 10.1038/s41592-022-01660-7. 10.1038/s41592-022-01660-7 PubMed 36344833