Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Tubulin-LSSmGFP
(Plasmid #186535)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 186535 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    n/a
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LSSmGFP
  • Species
    Synthetic
  • Insert Size (bp)
    717
  • Mutation
    hfYFP-T43S/G65S/L68Q/H77N/K140N/Y203I/V206K
  • Promoter CMV
  • Tag / Fusion Protein
    • Tubulin (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BshTI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CMV Forward (CGCAAATGGGCGGTAGGCGTG)
  • 3′ sequencing primer GACATGGACGAGCTGTACAAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

400 nm excitation, 510 nm emission.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Tubulin-LSSmGFP was a gift from Gregory Petsko (Addgene plasmid # 186535 ; http://n2t.net/addgene:186535 ; RRID:Addgene_186535)
  • For your References section:

    Chemically stable fluorescent proteins for advanced microscopy. Campbell BC, Paez-Segala MG, Looger LL, Petsko GA, Liu CF. Nat Methods. 2022 Nov 7. pii: 10.1038/s41592-022-01660-7. doi: 10.1038/s41592-022-01660-7. 10.1038/s41592-022-01660-7 PubMed 36344833