Skip to main content

pCytERM-LSSmGFP
(Plasmid #186540)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186540 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 186540-D50 50 μg of DNA in Tris buffer $495
DNA 186540-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    n/a
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LSSmGFP
  • Species
    Synthetic
  • Insert Size (bp)
    720
  • Mutation
    hfYFP-T43S/G65S/L68Q/H77N/K140N/Y203I/V206K
  • Promoter CMV
  • Tag / Fusion Protein
    • Cytochrome p450 first 29 animo acids (Oryctolagus cuniculus) (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BshTI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CMV Forward (CGCAAATGGGCGGTAGGCGTG)
  • 3′ sequencing primer SV40pA-R (GAAATTTGTGATGCTATTGC)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

400 nm excitation, 510 nm emission.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCytERM-LSSmGFP was a gift from Gregory Petsko (Addgene plasmid # 186540 ; http://n2t.net/addgene:186540 ; RRID:Addgene_186540)
  • For your References section:

    Chemically stable fluorescent proteins for advanced microscopy. Campbell BC, Paez-Segala MG, Looger LL, Petsko GA, Liu CF. Nat Methods. 2022 Nov 7. pii: 10.1038/s41592-022-01660-7. doi: 10.1038/s41592-022-01660-7. 10.1038/s41592-022-01660-7 PubMed 36344833