pCytERM-LSSmGFP
(Plasmid
#186540)
-
PurposeVisualization of the ER in cells using LSSmGFP (ex/em = 400/510 nm); compatible with OSER assay.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186540 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonen/a
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLSSmGFP
-
SpeciesSynthetic
-
Insert Size (bp)720
-
MutationhfYFP-T43S/G65S/L68Q/H77N/K140N/Y203I/V206K
- Promoter CMV
-
Tag
/ Fusion Protein
- Cytochrome p450 first 29 animo acids (Oryctolagus cuniculus) (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BshTI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CMV Forward (CGCAAATGGGCGGTAGGCGTG)
- 3′ sequencing primer SV40pA-R (GAAATTTGTGATGCTATTGC) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
400 nm excitation, 510 nm emission.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCytERM-LSSmGFP was a gift from Gregory Petsko (Addgene plasmid # 186540 ; http://n2t.net/addgene:186540 ; RRID:Addgene_186540) -
For your References section:
Chemically stable fluorescent proteins for advanced microscopy. Campbell BC, Paez-Segala MG, Looger LL, Petsko GA, Liu CF. Nat Methods. 2022 Nov 7. pii: 10.1038/s41592-022-01660-7. doi: 10.1038/s41592-022-01660-7. 10.1038/s41592-022-01660-7 PubMed 36344833