Skip to main content

pDYT002
(Plasmid #186550)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186550 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBA439
  • Backbone size w/o insert (bp) 9152
  • Total vector size (bp) 9152
  • Vector type
    Mammalian Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    14-bp random integration barcode and three target sites
  • Alt name
    lineage tracing target site vector
  • Species
    Synthetic
  • Insert Size (bp)
    291
  • Promoter EF1alpha

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTCACCATAACTGTAAAATT (for 3xsgRNA)
  • 3′ sequencing primer cggcatggacgagctgtacaag (for target site)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDYT002 was a gift from Jonathan Weissman (Addgene plasmid # 186550 ; http://n2t.net/addgene:186550 ; RRID:Addgene_186550)
  • For your References section:

    Lineage tracing reveals the phylodynamics, plasticity, and paths of tumor evolution. Yang D, Jones MG, Naranjo S, Rideout WM 3rd, Min KHJ, Ho R, Wu W, Replogle JM, Page JL, Quinn JJ, Horns F, Qiu X, Chen MZ, Freed-Pastor WA, McGinnis CS, Patterson DM, Gartner ZJ, Chow ED, Bivona TG, Chan MM, Yosef N, Jacks T, Weissman JS. Cell. 2022 Apr 28. pii: S0092-8674(22)00462-7. doi: 10.1016/j.cell.2022.04.015. 10.1016/j.cell.2022.04.015 PubMed 35523183