Skip to main content

pLV-Kif5a-Myc
(Plasmid #186613)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186613 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLV-eGFP_Addgene#36083
  • Total vector size (bp) 9816
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Kinesin Heavy Chain isoform 5A
  • Alt name
    Kif5a
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3096
  • GenBank ID
    NM_004984.4
  • Entrez Gene
    KIF5A (a.k.a. ALS25, D12S1889, MY050, NEIMY, NKHC, SPG10)
  • Promoter CMV
  • Tag / Fusion Protein
    • Myc tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer ggtgggaggtctatataagcagagc
  • 3′ sequencing primer ggcattaaagcagcgtatccacat
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV-Kif5a-Myc was a gift from Gia Voeltz (Addgene plasmid # 186613 ; http://n2t.net/addgene:186613 ; RRID:Addgene_186613)
  • For your References section:

    The ER ladder is a unique morphological feature of developing mammalian axons. Zamponi E, Meehl JB, Voeltz GK. Dev Cell. 2022 Jun 6;57(11):1369-1382.e6. doi: 10.1016/j.devcel.2022.05.002. Epub 2022 May 23. 10.1016/j.devcel.2022.05.002 PubMed 35609616