pLV-Kif5b-Myc
(Plasmid
#186614)
-
PurposeThird generation lentiviral vector expressing Kinesin Heavy Chain 5 isoform B fused to Myc tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186614 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLV-eGFP_Addgene#36083
- Total vector size (bp) 9609
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameKinesin Heavy Chain isoform 5b
-
Alt nameKif5b
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2889
-
GenBank IDNM_004521.3
-
Entrez GeneKIF5B (a.k.a. HEL-S-61, KINH, KNS, KNS1, UKHC)
- Promoter CMV
-
Tag
/ Fusion Protein
- Myc tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer gtgggaggtctatataagcagagctc
- 3′ sequencing primer tacaaaggcattaaagcagcgtat (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-Kif5b-Myc was a gift from Gia Voeltz (Addgene plasmid # 186614 ; http://n2t.net/addgene:186614 ; RRID:Addgene_186614) -
For your References section:
The ER ladder is a unique morphological feature of developing mammalian axons. Zamponi E, Meehl JB, Voeltz GK. Dev Cell. 2022 Jun 6;57(11):1369-1382.e6. doi: 10.1016/j.devcel.2022.05.002. Epub 2022 May 23. 10.1016/j.devcel.2022.05.002 PubMed 35609616