pTE1059
(Plasmid
#186628)
-
PurposeExpression of S. coelicolor butyrolactone biosynthesis genes in E. coli. Heterologous production of SCBs.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 186628 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBbA2k
- Backbone size w/o insert (bp) 2700
- Total vector size (bp) 5713
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namescbA
-
Alt nameSCO6266
-
SpeciesStreptomyces coelicolor M145
-
Insert Size (bp)942
- Promoter tetA
-
Tag
/ Fusion Protein
- 6xHis-thrombin (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer gatcttttaagaaggagatatacatATG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namescbB
-
Alt nameSCO6264
-
SpeciesStreptomyces coelicolor M145
-
Insert Size (bp)777
- Promoter Synthetic promoter B10
-
Tag
/ Fusion Protein
- 6xHis (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GTTTAACTTTAAGAAGGAGATATACCATG (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namescbC
-
Alt nameSCO6267
-
SpeciesStreptomyces coelicolor
-
Insert Size (bp)858
- Promoter Synthetic promoter B19
-
Tag
/ Fusion Protein
- 6xHis (C terminal on insert)
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer gtaacaaaagtgtctataatcacg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTE1059 was a gift from Eriko Takano (Addgene plasmid # 186628 ; http://n2t.net/addgene:186628 ; RRID:Addgene_186628) -
For your References section:
Orthogonal Regulatory Circuits for Escherichia coli Based on the gamma-Butyrolactone System of Streptomyces coelicolor. Biarnes-Carrera M, Lee CK, Nihira T, Breitling R, Takano E. ACS Synth Biol. 2018 Apr 20;7(4):1043-1055. doi: 10.1021/acssynbio.7b00425. Epub 2018 Mar 19. 10.1021/acssynbio.7b00425 PubMed 29510026