Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #47646)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 47646 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 3880
  • Total vector size (bp) 4652
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Insert Size (bp)
  • Mutation
    Changed Aspartic acid 91 to Glycine
  • Promoter Plac

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer gattacgcgcagaccaaaacgatc
  • 3′ sequencing primer gttgaaggctctcaagggcatcg
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

esaR-D91G (750bp, indicated as lowercase letters in the partial sequence) is located between KpnI and BamHI sites in pAC-EsaR in the same way as wt esaR in pAC-EsaR. Please see pAC-EsaR for lac promoter and terminator sequence information and plasmid map.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAC-EsaR-D91G was a gift from Cynthia Collins (Addgene plasmid # 47646 ; ; RRID:Addgene_47646)
  • For your References section:

    Directed evolution of the quorum-sensing regulator EsaR for increased signal sensitivity. Shong J, Huang YM, Bystroff C, Collins CH. ACS Chem Biol. 2013 Apr 19;8(4):789-95. doi: 10.1021/cb3006402. Epub 2013 Feb 6. 10.1021/cb3006402 PubMed 23363022