Skip to main content

pAC-EsaR
(Plasmid #47643)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 47643 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pACYC184
  • Backbone manufacturer
    NEB
  • Backbone size w/o insert (bp) 3518
  • Total vector size (bp) 4652
  • Modifications to backbone
    The tetracycline resistance gene in pACYC184 was removed.
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Plac-esaR-terminator
  • Insert Size (bp)
    1134
  • GenBank ID
  • Promoter Plac

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer gattacgcgcagaccaaaacgatc
  • 3′ sequencing primer gttgaaggctctcaagggcatcg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    We amplified the esaR gene from pTDM6 (Minogue, TD et al., 2002, Mol. Microbiol.).
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pAC-EsaR is an esaR expression vector. The esaR gene (750 bp, indicated as lowercase letters in the partial sequence for wt EsaR between KpnI and BamHI) is flanked by KpnI and BamHI sites.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAC-EsaR was a gift from Cynthia Collins (Addgene plasmid # 47643 ; http://n2t.net/addgene:47643 ; RRID:Addgene_47643)
  • For your References section:

    Directed evolution of the quorum-sensing regulator EsaR for increased signal sensitivity. Shong J, Huang YM, Bystroff C, Collins CH. ACS Chem Biol. 2013 Apr 19;8(4):789-95. doi: 10.1021/cb3006402. Epub 2013 Feb 6. 10.1021/cb3006402 PubMed 23363022