-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 41041 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepACYC184
-
Backbone manufacturerATCC
- Backbone size w/o insert (bp) 4245
- Total vector size (bp) 6211
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameprkA
-
Alt namePBAD-his6-prkA
-
Alt namephosphoribulokinase
-
SpeciesSynechococcus elongatus PCC 7942
-
Insert Size (bp)2611
-
GenBank IDWP_011242879.1
- Promoter PBAD
-
Tags
/ Fusion Proteins
- 6xHis (N terminal on insert)
- T7 epitope tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SphI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer pBAD-F (ATGCCATAGCATTTTTATCC)
- 3′ sequencing primer p15A-F (gattacgcgcagaccaaaac)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
PBAD-his6-prkA-pACYC184 confers resistance to working concentrations (~34 micrograms/mL) of chloramphenicol in E. coli. The copy number of the plasmid is relatively low because of its p15A origin.
Regarding its construction, the prkA gene was amplified in a PCR from whole Synechococcus PCC7942 cells using Vent polymerase and primers 5'SprkA (5'-GGGCCCGAGCTCGTCACTGTCTCGAGGGATCCTAT-3') and 3'SprkA (5'-CCGGGAAGCTTAGAGTCACACCGCTGAAAACAAGT-3'). The prkA gene was blunt-end cloned into EcoRV-cut pBS KS+, and sequenced to confirm its wild-type identity. It was subsequently subcloned into pET28a+ using restriction enzymes EcoRI and HindIII; this step fused the gene DNA sequence encoding an N-terminal hexa-histidine tag. The his6-prkA gene was subcloned into pBAD myc his A using restriction enzymes NcoI and HindIII. The araC-PBAD–his6-prkA expression cassette was subcloned into pACYC184 using SphI and HindIII. The final construct, PBAD-his6-prkA-pACYC184, contains the arabinose-inducible PBAD promoter, a fusion gene encoding a hexa-histidine-tagged phosphoribulokinase in the pACYC184 (low copy number, chloramphenicol-resistant) vector.
Plasmid features:
Type Start End Name
GENE 581 1493 p15A ori
GENE 2712 1567 6his-prkA
GENE 3048 3935 araC
GENE 5774 219 ChlR
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PBAD-his6-prkA-pACYC184 was a gift from Ichiro Matsumura (Addgene plasmid # 41041 ; http://n2t.net/addgene:41041 ; RRID:Addgene_41041) -
For your References section:
Directed evolution of RuBisCO hypermorphs through genetic selection in engineered E.coli. Parikh MR, Greene DN, Woods KK, Matsumura I. Protein Eng Des Sel. 2006 Mar;19(3):113-9. Epub 2006 Jan 19. 10.1093/protein/gzj010 PubMed 16423843