Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #47658)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 47658 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 8891
  • Total vector size (bp) 9177
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    EsaR promoter
  • Insert Size (bp)
  • Mutation
    Additional esa box between -35 site and the original esa box in PesaR
  • GenBank ID
  • Promoter PesaR-C

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer tattacgctgatgtccggcctgc
  • 3′ sequencing primer aatcatcactttcgggaa
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    PesaR-C was generated by commercial DNA synthesis.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

PesaR-C (274 bp, indicated as lowercase letters in the partial sequence) was cloned between XhoI and BamHI in the same was as wt PesaR in pET-PesaRlux. The -35 and -10 sites are uppercase in the partial sequence. Please see Figure S1 (Shong and Collins, ACS Synthetic Biology, 2013) for sequence alignment of PesaR and PesaR-D. See pET-PesaRlux for more details and plasmid map.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-PesaR-Clux was a gift from Cynthia Collins (Addgene plasmid # 47658 ; ; RRID:Addgene_47658)
  • For your References section:

    Engineering the esaR Promoter for Tunable Quorum Sensing-Dependent Gene Expression. Shong J, Collins CH. ACS Synth Biol. 2013 Jul 23. 10.1021/sb4000433 PubMed 23879176