pET-PesaR-Plux
(Plasmid
#47659)
-
PurposePesaR-P promoter, luxCDABE, and terminator in pET17b (AmpR)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 47659 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET-PesaRlux
- Backbone size w/o insert (bp) 8891
- Total vector size (bp) 9177
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePesaR-P
-
Insert Size (bp)286
-
MutationAdditional esa box downstream of the original esa box in PesaR
- Promoter PesaR-P
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer tattacgctgatgtccggcctgc
- 3′ sequencing primer aatcatcactttcgggaa (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPesaR-P was generated by commercial DNA synthesis.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
PesaR-P (274 bp, indicated as lowercase letters in the partial sequence) was cloned between XhoI and BamHI in the same was as wt PesaR in pET-PesaRlux. The -35 and -10 sites are uppercase in the partial sequence. Please see Figure S1 (Shong and Collins, ACS Synthetic Biology, 2013) for sequence alignment of PesaR and PesaR-D. See pET-PesaRlux for more details and plasmid map.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-PesaR-Plux was a gift from Cynthia Collins (Addgene plasmid # 47659 ; http://n2t.net/addgene:47659 ; RRID:Addgene_47659) -
For your References section:
Engineering the esaR Promoter for Tunable Quorum Sensing-Dependent Gene Expression. Shong J, Collins CH. ACS Synth Biol. 2013 Jul 23. 10.1021/sb4000433 PubMed 23879176