Nbr_C_sgRNA2
(Plasmid
#186664)
-
PurposeNbr C-tag sgRNA2 plasmid
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186664 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepU6-BbsI-chiRNA
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNbr sgRNA 2 Plasmid
-
gRNA/shRNA sequenceAGCTCCTCAATCACTTAACA
-
SpeciesD. melanogaster (fly)
-
Entrez GeneNbr (a.k.a. Dmel_CG9247, CG9247, Dmel\CG9247, nbr)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer Unknown (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
sgRNA sequence: AGCTCCTCAATCACTTAACA. The corresponding genome sequence is: AGCTCCTCAATCACTTAACA.
Please visit https://www.biorxiv.org/content/10.1101/2020.12.18.423517v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Nbr_C_sgRNA2 was a gift from Astrid Haase (Addgene plasmid # 186664 ; http://n2t.net/addgene:186664 ; RRID:Addgene_186664) -
For your References section:
Functional editing of endogenous genes through rapid selection of cell pools (Rapid generation of endogenously tagged genes in Drosophila ovarian somatic sheath cells). Meng Q, Stoyko D, Andrews CM, Konstantinidou P, Genzor P, O T, Elchert AR, Benner L, Sobti S, Katz EY, Haase AD. Nucleic Acids Res. 2022 May 27. pii: 6594084. doi: 10.1093/nar/gkac448. 10.1093/nar/gkac448 PubMed 35639929