Skip to main content

peGFP-N1-Cofilin-S41E
(Plasmid #186748)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186748 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-N1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cofilin-1
  • Alt name
    p18
  • Alt name
    CFL1
  • Species
    H. sapiens (human)
  • Mutation
    Changed serine 41 to glutamic acid
  • GenBank ID
    NM_005507.2
  • Entrez Gene
    CFL1 (a.k.a. CFL, HEL-S-15, cofilin)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer TAACAACTCCGCCCCATT
  • 3′ sequencing primer GTCCAGCTCGACCAGGATGGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Synthetic gene

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    peGFP-N1-Cofilin-S41E was a gift from Geert van den Bogaart (Addgene plasmid # 186748 ; http://n2t.net/addgene:186748 ; RRID:Addgene_186748)
  • For your References section:

    Atypical cofilin signaling drives dendritic cell migration through the extracellular matrix via nuclear deformation. Warner H, Franciosa G, van der Borg G, Coenen B, Faas F, Koenig C, de Boer R, Classens R, Maassen S, Baranov MV, Mahajan S, Dabral D, Bianchi F, van Hilten N, Risselada HJ, Roos WH, Olsen JV, Cano LQ, van den Bogaart G. Cell Rep. 2024 Feb 27;43(3):113866. doi: 10.1016/j.celrep.2024.113866. 10.1016/j.celrep.2024.113866 PubMed 38416638