lentiCRISPR v2 sgKEAP1-3
(Plasmid
#186837)
-
Purposeknock out KEAP1 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186837 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonelentiCRISPR v2
-
Backbone manufacturerFeng Zhang
- Backbone size w/o insert (bp) 12000
- Total vector size (bp) 12000
-
Vector typeLentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKeap1 (Kelch-like ECH-associated protein 1)
-
gRNA/shRNA sequenceCACCGGAGGACACACTTCTCGCCCA
-
SpeciesH. sapiens (human)
-
Entrez GeneKEAP1 (a.k.a. INrf2, KLHL19)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer U6 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lentiCRISPR v2 sgKEAP1-3 was a gift from Boyi Gan (Addgene plasmid # 186837 ; http://n2t.net/addgene:186837 ; RRID:Addgene_186837) -
For your References section:
A targetable CoQ-FSP1 axis drives ferroptosis- and radiation-resistance in KEAP1 inactive lung cancers. Koppula P, Lei G, Zhang Y, Yan Y, Mao C, Kondiparthi L, Shi J, Liu X, Horbath A, Das M, Li W, Poyurovsky MV, Olszewski K, Gan B. Nat Commun. 2022 Apr 22;13(1):2206. doi: 10.1038/s41467-022-29905-1. 10.1038/s41467-022-29905-1 PubMed 35459868