pRRL-pEF-H2B-mCherry-T2A-rTetR-Dest-SV40
(Plasmid
#186968)
-
PurposeLentiviral destination vector for cloning desired protein as rTetR fusion for chromatin regulation reporter (pEF-H2B-mCherry-T2A-rTetR, with SV40) for expression in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 186968 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRRL
- Backbone size w/o insert (bp) 5473
- Total vector size (bp) 8968
-
Modifications to backboneRemoved 3' KpnI site (after SV40)
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersmCherry (fluorescence)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepEF-H2B-mCherry-T2A-rTetR-Dest-SV40
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)3546
- Promoter EF-1alpha promoter
-
Tag
/ Fusion Protein
- rTetR fusion (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site KpnI (destroyed during cloning)
- 5′ sequencing primer cPPT-SF ATAGTAGACATAATAGCAACAGACATAC
- 3′ sequencing primer SV40-SF GGTACCAGGTAAGTGTACCCAA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypEF-H2B-mCherry-T2A-rTetR and SV40 were amplified from pEX1-pEF-H2B-mCherry-T2A-rTetR-KRAB, a gift from M. Elowitz (Addgene #78348). The pRRL vector backbone was prepared by restriction digest of LT3REVIR, a gift from J. Zuber (Addgene #111176).
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid is a destination vector for cloning a protein of interest into the reporter recruiter cassette (as a fusion to rTetR). The vector can be linearized through digestion with KpnI.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRRL-pEF-H2B-mCherry-T2A-rTetR-Dest-SV40 was a gift from Brian Liau (Addgene plasmid # 186968 ; http://n2t.net/addgene:186968 ; RRID:Addgene_186968) -
For your References section:
Base editor scanning charts the DNMT3A activity landscape. Lue NZ, Garcia EM, Ngan KC, Lee C, Doench JG, Liau BB. Nat Chem Biol. 2023 Feb;19(2):176-186. doi: 10.1038/s41589-022-01167-4. Epub 2022 Oct 20. 10.1038/s41589-022-01167-4 PubMed 36266353