Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

PhiC31-Neo-ins-5xTetO-pEF-H2B-Citrine-ins
(Plasmid #78099)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 78099 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSLR-test
  • Backbone manufacturer
    Toyobo, Osaka, Japan
  • Backbone size w/o insert (bp) 9432
  • Total vector size (bp) 12550
  • Modifications to backbone
    replaced the SLR gene with Neo (blunt-end ligation after digesting pSLR-test with EcoRV/SmaI, see PLoS One 6.2 (2011): e17267) introduced MCS with 2 cHS4 insulators on each side
  • Vector type
    Mammalian Expression, Synthetic Biology
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Histone H2B - Citrine
  • Alt name
    histone cluster 2, H2be
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    3080
  • GenBank ID
    https://www.ncbi.nlm.nih.gov/gene/8349
  • Entrez Gene
    H2BC21 (a.k.a. GL105, H2B, H2B-GL105, H2B.1, H2BE, H2BFQ, H2BGL105, H2BQ, HIST2H2BE)
  • Promoter 5xTetO pEF alpha

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCIF_3 GAAGACGTCGATATACGCGT
  • 3′ sequencing primer TCIR_5 GGAGCTCCACCCTAGAACTA
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Can be used for constitutive expression of H2B-citrine.
Can be silenced by TetR-KRAB or rTetR-KRAB (using doxycycline).
It can be site-specifically integrated in a PhiC31 attP site (the plasmid contains a PhiC31 attB site).
The reporter gene is flanked by two full length (1.2kb each) chicken HS4 insulators on each side.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PhiC31-Neo-ins-5xTetO-pEF-H2B-Citrine-ins was a gift from Michael Elowitz (Addgene plasmid # 78099 ; http://n2t.net/addgene:78099 ; RRID:Addgene_78099)
  • For your References section:

    Dynamics of epigenetic regulation at the single-cell level. Bintu L, Yong J, Antebi YE, McCue K, Kazuki Y, Uno N, Oshimura M, Elowitz MB. Science. 2016 Feb 12;351(6274):720-4. doi: 10.1126/science.aab2956. 10.1126/science.aab2956 PubMed 26912859