Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pEx1-pEF-H2B-mCherry-T2A-rTetR-HDAC4-Zeo
(Plasmid #78353)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 78353 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pExchange1
  • Backbone manufacturer
    Agilent Technologies
  • Backbone size w/o insert (bp) 6615
  • Total vector size (bp) 11655
  • Modifications to backbone
    original CMV was replaced with pEF cut with BamHI and KpnI before Gibson inserted Zeo in the loxP site using Cre
  • Vector type
    Mammalian Expression, Synthetic Biology
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    H2B-mCherry-T2A-rTetR-HDAC4
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    5040
  • GenBank ID
    https://www.ncbi.nlm.nih.gov/gene/9759
  • Entrez Gene
    HDAC4 (a.k.a. AHO3, BDMR, HA6116, HD4, HDAC-4, HDAC-A, HDACA)
  • Promoter pEF alpha
  • Tag / Fusion Protein
    • rTetR (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer F1-factor: CTAAAGTGCGAAAGCGGCGG
  • 3′ sequencing primer T7 primer: TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEx1-pEF-H2B-mCherry-T2A-rTetR-HDAC4-Zeo was a gift from Michael Elowitz (Addgene plasmid # 78353 ; http://n2t.net/addgene:78353 ; RRID:Addgene_78353)
  • For your References section:

    Dynamics of epigenetic regulation at the single-cell level. Bintu L, Yong J, Antebi YE, McCue K, Kazuki Y, Uno N, Oshimura M, Elowitz MB. Science. 2016 Feb 12;351(6274):720-4. doi: 10.1126/science.aab2956. 10.1126/science.aab2956 PubMed 26912859