Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #78101)


Item Catalog # Description Quantity Price (USD)
Plasmid 78101 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Agilent Technologies
  • Backbone size w/o insert (bp) 4113
  • Total vector size (bp) 7227
  • Modifications to backbone
    original CMV was replaced with pEF cut with BamHI and KpnI before Gibson
  • Vector type
    Mammalian Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    EED (a.k.a. COGIS, HEED, WAIT1)
  • Promoter pEF alpha
  • Tag / Fusion Protein
    • rTetR (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer F1-factor: CTAAAGTGCGAAAGCGGCGG
  • 3′ sequencing primer T7 primer: TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    pCMV-HA-EED was purchased from Addgene (; rTetR was PCR-amplified from the rtTA3 system, Clontech

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEx1-pEF-H2B-mCherry-T2A-rTetR-EED was a gift from Michael Elowitz (Addgene plasmid # 78101 ; ; RRID:Addgene_78101)
  • For your References section:

    Dynamics of epigenetic regulation at the single-cell level. Bintu L, Yong J, Antebi YE, McCue K, Kazuki Y, Uno N, Oshimura M, Elowitz MB. Science. 2016 Feb 12;351(6274):720-4. doi: 10.1126/science.aab2956. 10.1126/science.aab2956 PubMed 26912859