pPB-CAG-Dnmt3a2-Ires2-mCherry-SV40
(Plasmid
#186969)
-
PurposePiggyBac vector encoding mouse Dnmt3a2 with Ires2-mCherry fluorescent marker for expression in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186969 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepPB
-
Backbone manufacturerSystem Biosciences
- Backbone size w/o insert (bp) 4846
- Total vector size (bp) 8782
-
Vector typeMammalian Expression ; PiggyBac
-
Selectable markersmCherry (fluorescence)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDnmt3a2
-
SpeciesM. musculus (mouse), Synthetic
-
Insert Size (bp)3975
-
MutationIsoform 2 (residues 220–908)
-
GenBank IDNM_007872.4
-
Entrez GeneDnmt3a (a.k.a. MmuIIIA)
- Promoter CAG
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CAG-SF TTATGGTAATCGTGCGAGAGG
- 3′ sequencing primer SV40-SF GGTACCAGGTAAGTGTACCCAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byIres2-mCherry was derived from Cilantro2, a gift from B. Ebert (Addgene #74450). SV40 was derived from PhiC31-Neo-ins-5xTetO-pEF-H2B-Citrine-ins, a gift from M. Elowitz (Addgene #78099). The pPB vector backbone was prepared by restriction digest of pSLQ2817, a gift from S. Qi (Addgene #84239).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPB-CAG-Dnmt3a2-Ires2-mCherry-SV40 was a gift from Brian Liau (Addgene plasmid # 186969 ; http://n2t.net/addgene:186969 ; RRID:Addgene_186969) -
For your References section:
Base editor scanning charts the DNMT3A activity landscape. Lue NZ, Garcia EM, Ngan KC, Lee C, Doench JG, Liau BB. Nat Chem Biol. 2023 Feb;19(2):176-186. doi: 10.1038/s41589-022-01167-4. Epub 2022 Oct 20. 10.1038/s41589-022-01167-4 PubMed 36266353