pSBK.009
(Plasmid
#187209)
-
PurposeExpresses retron Eco1 ncRNA v35 (long a1/a2, barcode 1 [CCT-AGG]), and Cas1 + Cas2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 187209 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepRSFDuet-1
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 3829
- Total vector size (bp) 5212
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameRetron Eco1 ncRNA v35 (long a1/a2, barcode 1 [CCT-AGG])
-
SpeciesE. coli
-
Insert Size (bp)203
- Promoter T7/Lac
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer CACGCGGTTGGGAATGTAAT
- 3′ sequencing primer TATGCGGCCGTGTACAATAC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCas1 + Cas2
-
Alt nameCas1+2
-
SpeciesE. coli
-
Insert Size (bp)1204
- Promoter T7/Lac
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ATCATCACCACAGCCAGGAT
- 3′ sequencing primer ATGTGCTGGCGTTCAAATTTCGCAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
P35Q mutation in Cas2 insert does not affect plasmid function.
Please visit https://doi.org/10.1101/2021.08.11.455990 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSBK.009 was a gift from Seth Shipman (Addgene plasmid # 187209 ; http://n2t.net/addgene:187209 ; RRID:Addgene_187209) -
For your References section:
Recording gene expression order in DNA by CRISPR addition of retron barcodes. Bhattarai-Kline S, Lear SK, Fishman CB, Lopez SC, Lockshin ER, Schubert MG, Nivala J, Church GM, Shipman SL. Nature. 2022 Aug;608(7921):217-225. doi: 10.1038/s41586-022-04994-6. Epub 2022 Jul 27. 10.1038/s41586-022-04994-6 PubMed 35896746