Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGAPDH::sNluc1
(Plasmid #187221)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 187221 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDEST-R4-R3
  • Backbone manufacturer
    ThermoFisher
  • Backbone size w/o insert (bp) 6724
  • Total vector size (bp) 7240
  • Vector type
    Overexpression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Nanoluciferase
  • Species
    Schmidtea mediterranea
  • Insert Size (bp)
    516
  • Promoter GAPDH

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CAGGAAACAGCTATGACCATG
  • 3′ sequencing primer TGTAAAACGACGGCCAGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGAPDH::sNluc1 was a gift from Bo Wang (Addgene plasmid # 187221 ; http://n2t.net/addgene:187221 ; RRID:Addgene_187221)
  • For your References section:

    Heterologous reporter expression in the planarian Schmidtea mediterranea through somatic mRNA transfection. Hall RN, Weill U, Drees L, Leal-Ortiz S, Li H, Khariton M, Chai C, Xue Y, Rosental B, Quake SR, Sanchez Alvarado A, Melosh NA, Fire AZ, Rink JC, Wang B. Cell Rep Methods. 2022 Sep 20;2(10):100298. doi: 10.1016/j.crmeth.2022.100298. eCollection 2022 Oct 24. 10.1016/j.crmeth.2022.100298 PubMed 36313809