Skip to main content
Addgene

pLL5.0-Anillin shRNA
(Plasmid #187270)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187270 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLL5.0
  • Backbone size w/o insert (bp) 7568
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shRNA for Anillin
  • Alt name
    Anillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra)
  • gRNA/shRNA sequence
    TCGGCGATGCCTCTTTGAATAAATTCAAGAGATTTATTCAAAGAGGCATCGCCATTTTTT
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    60
  • Entrez Gene
    ANLN (a.k.a. FSGS8, Scraps, scra)
  • Promoter U6
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Plasmid made by Srikanth Budnar

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

5' cloning site: Hpa1 (destroyed), 3' cloning site: Xho1 (not destroyed).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLL5.0-Anillin shRNA was a gift from Alpha Yap (Addgene plasmid # 187270 ; http://n2t.net/addgene:187270 ; RRID:Addgene_187270)
  • For your References section:

    Anillin Promotes Cell Contractility by Cyclic Resetting of RhoA Residence Kinetics. Budnar S, Husain KB, Gomez GA, Naghibosadat M, Varma A, Verma S, Hamilton NA, Morris RG, Yap AS. Dev Cell. 2019 Jun 17;49(6):894-906.e12. doi: 10.1016/j.devcel.2019.04.031. Epub 2019 May 16. 10.1016/j.devcel.2019.04.031 PubMed 31105010