pAAV-ND4 Right-GSVG-UGI
(Plasmid
#187414)
-
Purposehuman mitochondrial DNA ND4 target TALE
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 187414 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
-
Vector typeMammalian Expression, AAV, TALEN
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDddA GSVG variant
-
SpeciesH. sapiens (human)
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer acgatgtccctgattatgctgggatccgaattcaagatctgcgtaccctgggttacag
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-ND4 Right-GSVG-UGI was a gift from Jin-Soo Kim (Addgene plasmid # 187414 ; http://n2t.net/addgene:187414 ; RRID:Addgene_187414) -
For your References section:
Base editing in human cells with monomeric DddA-TALE fusion deaminases. Mok YG, Lee JM, Chung E, Lee J, Lim K, Cho SI, Kim JS. Nat Commun. 2022 Jul 12;13(1):4038. doi: 10.1038/s41467-022-31745-y. 10.1038/s41467-022-31745-y PubMed 35821233