Skip to main content

ATP1A1_G6_T804N_v1_Dual_epegRNA_tevopreQ1
(Plasmid #187458)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187458 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pU6-tevopreq1-GG-acceptor
  • Backbone size w/o insert (bp) 3041
  • Total vector size (bp) 3475
  • Vector type
    Mammalian Expression, CRISPR ; Prime editing

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ATP1A1 G6 T804N epegRNA (tevopreQ1)
  • gRNA/shRNA sequence
    GCAAACATTCCACTACCACT
  • Species
    H. sapiens (human)
  • Entrez Gene
    ATP1A1 (a.k.a. CMT2DD, HOMGSMR2)
  • Promoter Tandem U6 promoters

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsrGI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer CAGGGTTATTGTCTCATGAGCGG
  • 3′ sequencing primer GGGAAACGCCTGGTATCTTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Prime editing vector derived from pU6-tevopreq1-GG-acceptor. See Nelson et al. Nature Biotechnology (2021) for the detailed epegRNA (tevopreq1) cloning protocol to target your gene of interest. False-positive colonies will appear pink or red if the RFP insert has not been replaced by the new epegRNA cassette. The ATP1A1_G6_T804N_v1_Dual_epegRNA_tevopreq1 can be used in more challenging settings to generate ouabain-resistant cells.

Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ATP1A1_G6_T804N_v1_Dual_epegRNA_tevopreQ1 was a gift from Yannick Doyon (Addgene plasmid # 187458 ; http://n2t.net/addgene:187458 ; RRID:Addgene_187458)
  • For your References section:

    Marker-free co-selection for successive rounds of prime editing in human cells. Levesque S, Mayorga D, Fiset JP, Goupil C, Duringer A, Loiselle A, Bouchard E, Agudelo D, Doyon Y. Nat Commun. 2022 Oct 7;13(1):5909. doi: 10.1038/s41467-022-33669-z. 10.1038/s41467-022-33669-z PubMed 36207338