Skip to main content

AAV.CAG.GLPLight1
(Plasmid #187467)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187467 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV.CAG
  • Backbone manufacturer
    Viral Vector Facility - University of Zurich
  • Backbone size w/o insert (bp) 4715
  • Total vector size (bp) 6872
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    GLPLight1
  • Species
    Synthetic
  • Insert Size (bp)
    2157
  • GenBank ID
  • Promoter CAG
  • Tag / Fusion Protein
    • Flag tag (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer gggacggctgccttcg
  • 3′ sequencing primer gatacaaaggcattaaagcagcg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.02.14.528498 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV.CAG.GLPLight1 was a gift from Tommaso Patriarchi (Addgene plasmid # 187467 ; http://n2t.net/addgene:187467 ; RRID:Addgene_187467)
  • For your References section:

    Optical tools for visualizing and controlling human GLP-1 receptor activation with high spatiotemporal resolution. Duffet L, Williams ET, Gresch A, Chen S, Bhat MA, Benke D, Hartrampf N, Patriarchi T. Elife. 2023 Jun 2;12:RP86628. doi: 10.7554/eLife.86628. 10.7554/eLife.86628 PubMed 37265064