AAV.CAG.GLPLight1
(Plasmid
#187467)
-
PurposeExpresses GLPLight1 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 187467 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV.CAG
-
Backbone manufacturerViral Vector Facility - University of Zurich
- Backbone size w/o insert (bp) 4715
- Total vector size (bp) 6872
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGLPLight1
-
SpeciesSynthetic
-
Insert Size (bp)2157
-
GenBank ID
- Promoter CAG
-
Tag
/ Fusion Protein
- Flag tag (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer gggacggctgccttcg
- 3′ sequencing primer gatacaaaggcattaaagcagcg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.02.14.528498 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV.CAG.GLPLight1 was a gift from Tommaso Patriarchi (Addgene plasmid # 187467 ; http://n2t.net/addgene:187467 ; RRID:Addgene_187467) -
For your References section:
Optical tools for visualizing and controlling human GLP-1 receptor activation with high spatiotemporal resolution. Duffet L, Williams ET, Gresch A, Chen S, Bhat MA, Benke D, Hartrampf N, Patriarchi T. Elife. 2023 Jun 2;12:RP86628. doi: 10.7554/eLife.86628. 10.7554/eLife.86628 PubMed 37265064