Skip to main content

pET-His6MBP-A3A-Gly6His6
(Plasmid #187822)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187822 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET His6 MBP prescission LIC cloning vector (HMPKS, Addgene Plasmid #29721)
  • Backbone size w/o insert (bp) 8106
  • Total vector size (bp) 7108
  • Modifications to backbone
    The gBlock Gene Fragment, including a full-length CDS of codon-optimized human APOBEC3A (A3A) with PreScission protease cleavage sequences on both sides, was inserted between the SspI and XhoI cleavage sites.
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    The A3A protein may cause mutation of this vector. Please culture individual clones and sequence them after bacterial transformation.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    APOBEC3A
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    597
  • Mutation
    none
  • GenBank ID
    NM_145699
  • Entrez Gene
    APOBEC3A (a.k.a. A3A, ARP3, PHRBN, bK150C2.1)
  • Promoter T7 promoter (on the backbone)
  • Tag / Fusion Protein
    • His6 and MBP

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GATGAAGCCCTGAAAGACGCGCAG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-His6MBP-A3A-Gly6His6 was a gift from Hao Wu (Addgene plasmid # 187822 ; http://n2t.net/addgene:187822 ; RRID:Addgene_187822)
  • For your References section:

    Joint single-cell profiling resolves 5mC and 5hmC and reveals their distinct gene regulatory effects. Fabyanic EB, Hu P, Qiu Q, Berrios KN, Connolly DR, Wang T, Flournoy J, Zhou Z, Kohli RM, Wu H. Nat Biotechnol. 2023 Aug 28. doi: 10.1038/s41587-023-01909-2. 10.1038/s41587-023-01909-2 PubMed 37640946