pET-His6MBP-A3A-Gly6His6
(Plasmid
#187822)
-
PurposeExpression human APOBEC3A in E.coli.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 187822 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET His6 MBP prescission LIC cloning vector (HMPKS, Addgene Plasmid #29721)
- Backbone size w/o insert (bp) 8106
- Total vector size (bp) 7108
-
Modifications to backboneThe gBlock Gene Fragment, including a full-length CDS of codon-optimized human APOBEC3A (A3A) with PreScission protease cleavage sequences on both sides, was inserted between the SspI and XhoI cleavage sites.
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsThe A3A protein may cause mutation of this vector. Please culture individual clones and sequence them after bacterial transformation.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameAPOBEC3A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)597
-
Mutationnone
-
GenBank IDNM_145699
-
Entrez GeneAPOBEC3A (a.k.a. A3A, ARP3, PHRBN, bK150C2.1)
- Promoter T7 promoter (on the backbone)
-
Tag
/ Fusion Protein
- His6 and MBP
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GATGAAGCCCTGAAAGACGCGCAG
- 3′ sequencing primer GCTAGTTATTGCTCAGCG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-His6MBP-A3A-Gly6His6 was a gift from Hao Wu (Addgene plasmid # 187822 ; http://n2t.net/addgene:187822 ; RRID:Addgene_187822) -
For your References section:
Joint single-cell profiling resolves 5mC and 5hmC and reveals their distinct gene regulatory effects. Fabyanic EB, Hu P, Qiu Q, Berrios KN, Connolly DR, Wang T, Flournoy J, Zhou Z, Kohli RM, Wu H. Nat Biotechnol. 2023 Aug 28. doi: 10.1038/s41587-023-01909-2. 10.1038/s41587-023-01909-2 PubMed 37640946