Skip to main content

pEA106
(Plasmid #187872)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187872 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTF505
  • Backbone manufacturer
    Keunsub Lee
  • Backbone size w/o insert (bp) 6149
  • Total vector size (bp) 7214
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin and Streptomycin, 50 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry
  • Alt name
    monomeric derivative of DsRed fluorescent protein
  • Insert Size (bp)
    711
  • GenBank ID
    AY678264.1 AAV52164.1
  • Promoter Agrobacterium virB promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer cgaattgtattgattggtgagct
  • 3′ sequencing primer ctatagcagcggaggggttg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEA106 was a gift from Kan Wang (Addgene plasmid # 187872 ; http://n2t.net/addgene:187872 ; RRID:Addgene_187872)
  • For your References section:

    CRISPR RNA-guided integrase enables high-efficiency targeted genome engineering in Agrobacterium tumefaciens. Aliu E, Lee K, Wang K. Plant Biotechnol J. 2022 Jun 11. doi: 10.1111/pbi.13872. 10.1111/pbi.13872 PubMed 35690588
Commonly requested with: