pKL2315
(Plasmid
#187876)
-
PurposeExpresses Cre recombinase.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 187876 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepTF505
-
Backbone manufacturerKeunsub Lee
- Backbone size w/o insert (bp) 6149
- Total vector size (bp) 9194
-
Modifications to backboneCre recombinase and sacB expression cassettes were cloned.
-
Vector typeBacterial Expression, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCre recombinase
-
Insert Size (bp)1032
-
GenBank IDMF405193.1
- Promoter J23107
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CAACACATGAGCGAAACCCT
- 3′ sequencing primer CTATAGCAGCGGAGGGGTTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: Plasmid contains a R139S mutation in Cre recombinase. This mutation is not known to affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKL2315 was a gift from Kan Wang (Addgene plasmid # 187876 ; http://n2t.net/addgene:187876 ; RRID:Addgene_187876) -
For your References section:
CRISPR RNA-guided integrase enables high-efficiency targeted genome engineering in Agrobacterium tumefaciens. Aliu E, Lee K, Wang K. Plant Biotechnol J. 2022 Jun 11. doi: 10.1111/pbi.13872. 10.1111/pbi.13872 PubMed 35690588