pSAC200
(Plasmid
#187911)
-
Purpose(Empty Backbone) psac200-crispey-bar-vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 187911 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepRS416
-
Vector typeYeast Expression, CRISPR
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GCAGGTCGGAAATATTTATGGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.06.05.494888v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSAC200 was a gift from Hunter Fraser (Addgene plasmid # 187911 ; http://n2t.net/addgene:187911 ; RRID:Addgene_187911) -
For your References section:
Gene-by-environment interactions are pervasive among natural genetic variants. Chen SA, Kern AF, Ang RML, Xie Y, Fraser HB. Cell Genom. 2023 Feb 28;3(4):100273. doi: 10.1016/j.xgen.2023.100273. eCollection 2023 Apr 12. 10.1016/j.xgen.2023.100273 PubMed 37082145