pGB-GST-3C-mCherry-ATG14/Vps34/Vps15/BECN1
(Plasmid
#187936)
-
PurposePlasmid for the expression and purification of GST-3C-mCherry-ATG14/Vps34/Vps15/BECN1 in Spodoptera frugiperda cells (Sf9). Internal reference: SMC1327
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 187936 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGBdest
-
Backbone manufacturerVienna Biocenter Core Facilities GmbH, Vienna, Austria
- Backbone size w/o insert (bp) 4958
- Total vector size (bp) 17204
-
Vector typeBacterial Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameATG14
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2886
-
GenBank ID22863
-
Entrez GeneATG14 (a.k.a. ATG14L, BARKOR, KIAA0831)
-
Tag
/ Fusion Protein
- GST-mCherry (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gateway Cloning
- 5′ sequencing primer GACTCTGCCATGACC
- 3′ sequencing primer TACCTATGTCCA
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameVPS34
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2664
-
GenBank ID5289
-
Entrez GenePIK3C3 (a.k.a. VPS34, Vps34, hVps34)
Cloning Information for Gene/Insert 2
- Cloning method Gateway Cloning
- 5′ sequencing primer TGTACTACGAGAAGG
- 3′ sequencing primer GGCCAGAGTAGAGTT
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameVPS15
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2664
-
GenBank ID30849
-
Entrez GenePIK3R4 (a.k.a. VPS15, p150)
Cloning Information for Gene/Insert 3
- Cloning method Gateway Cloning
- 5′ sequencing primer TGAAGAGGGCTATGG
- 3′ sequencing primer CAGCGCTCTTGTGTT
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameBECN1
-
Alt namebeclin1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1353
-
GenBank ID8678
-
Entrez GeneBECN1 (a.k.a. ATG6, VPS30, beclin1)
Cloning Information for Gene/Insert 4
- Cloning method Gateway Cloning
- 5′ sequencing primer ATGGAGGGTTCTAAGACC
- 3′ sequencing primer TATTTGTTGTAGAACTGCGA
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Manufactured by the ProTech Facility VBCF Vienna, Austria.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGB-GST-3C-mCherry-ATG14/Vps34/Vps15/BECN1 was a gift from Sascha Martens (Addgene plasmid # 187936 ; http://n2t.net/addgene:187936 ; RRID:Addgene_187936) -
For your References section:
Unconventional initiation of PINK1/Parkin mitophagy by Optineurin. Nguyen TN, Sawa-Makarska J, Khuu G, Lam WK, Adriaenssens E, Fracchiolla D, Shoebridge S, Bernklau D, Padman BS, Skulsuppaisarn M, Lindblom RSJ, Martens S, Lazarou M. Mol Cell. 2023 May 18;83(10):1693-1709.e9. doi: 10.1016/j.molcel.2023.04.021. 10.1016/j.molcel.2023.04.021 PubMed 37207627