Skip to main content
Addgene

pSLQ2818_Blasti_pPB: CAG-PYL1-KRAB-IRES-Blasti-WPRE-SV40PA PGK-ABI-tagBFP-SpdCas9-FKBP_F36V
(Plasmid #187959)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187959 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSLQ2818_Blasti_pPB: CAG-PYL1-KRAB-IRES-Blasti-WPRE-SV40PA PGK-ABI-tagBFP-SpdCas9
  • Backbone size w/o insert (bp) 13866
  • Total vector size (bp) 14235
  • Vector type
    Mammalian Expression, CRISPR, Synthetic Biology
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Blasticidin resistance

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site PmeI (not destroyed)
  • 5′ sequencing primer GCCAAGCCTTTGTCTCAAG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    FKBP12_F36V
  • Alt name
    FKBP12 (F36V mutant)
  • Species
    H. sapiens (human), Synthetic
  • Tag / Fusion Protein
    • GGS linker (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGCGGATCTGGAGGTAGTG
  • 3′ sequencing primer CTATTCCAGTTTTAGAAGCTCCACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLQ2818_Blasti_pPB: CAG-PYL1-KRAB-IRES-Blasti-WPRE-SV40PA PGK-ABI-tagBFP-SpdCas9-FKBP_F36V was a gift from Edda Schulz (Addgene plasmid # 187959 ; http://n2t.net/addgene:187959 ; RRID:Addgene_187959)
  • For your References section:

    CasTuner is a degron and CRISPR/Cas-based toolkit for analog tuning of endogenous gene expression. Noviello G, Gjaltema RAF, Schulz EG. Nat Commun. 2023 Jun 3;14(1):3225. doi: 10.1038/s41467-023-38909-4. 10.1038/s41467-023-38909-4 PubMed 37270532