Skip to main content

pCMV-BLZinCh-P30
(Plasmid #188056)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 188056 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCMV
  • Backbone size w/o insert (bp) 3934
  • Total vector size (bp) 6014
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BLZinCh-P30
  • Insert Size (bp)
    2080
  • Promoter CMV promotor

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GGTGGGAGGTCTATATAAGC
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-BLZinCh-P30 was a gift from Maarten Merkx (Addgene plasmid # 188056 ; http://n2t.net/addgene:188056 ; RRID:Addgene_188056)
  • For your References section:

    Ratiometric Bioluminescent Zinc Sensor Proteins to Quantify Serum and Intracellular Free Zn(2). Michielsen CMS, van Aalen EA, Merkx M. ACS Chem Biol. 2022 Jun 17;17(6):1567-1576. doi: 10.1021/acschembio.2c00227. Epub 2022 May 25. 10.1021/acschembio.2c00227 PubMed 35611686