pCMV-BLZinCh-P40
(Plasmid
#188057)
-
PurposeExpression of BLZinCh-P40, a dual read-out BRET-FRET sensor for intracellular Zn2+ imaging, in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 188057 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCMV
- Backbone size w/o insert (bp) 3934
- Total vector size (bp) 6043
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBLZinCh-P40
-
Insert Size (bp)2109
- Promoter CMV promotor
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GGTGGGAGGTCTATATAAGC
- 3′ sequencing primer GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-BLZinCh-P40 was a gift from Maarten Merkx (Addgene plasmid # 188057 ; http://n2t.net/addgene:188057 ; RRID:Addgene_188057) -
For your References section:
Ratiometric Bioluminescent Zinc Sensor Proteins to Quantify Serum and Intracellular Free Zn(2). Michielsen CMS, van Aalen EA, Merkx M. ACS Chem Biol. 2022 Jun 17;17(6):1567-1576. doi: 10.1021/acschembio.2c00227. Epub 2022 May 25. 10.1021/acschembio.2c00227 PubMed 35611686