Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pCAG-MBP-Foldon-ATG9 (692-839)
(Plasmid #188087)


Item Catalog # Description Quantity Price (USD)
Plasmid 188087 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.


  • Vector backbone
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    MBP-TEVsite-Foldon-ATG9 (692-839)-stop
  • Species
    H. sapiens (human)
  • Mutation
    ATG9 (692-839)
  • Entrez Gene
    ATG9A (a.k.a. APG9L1, MGD3208, mATG9)
  • Promoter CMV
  • Tag / Fusion Protein
    • MBP tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 3′ cloning site KpnI (unknown if destroyed)
  • 5′ sequencing primer ccgctttctggtatgccgtgcg
  • 3′ sequencing primer gagccagggcattggccacac
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-MBP-Foldon-ATG9 (692-839) was a gift from James Hurley (Addgene plasmid # 188087 ; ; RRID:Addgene_188087)
  • For your References section:

    Structural basis for ATG9A recruitment to the ULK1 complex in mitophagy initiation. Ren X, Nguyen TN, Lam WK, Buffalo CZ, Lazarou M, Yokom AL, Hurley JH. Sci Adv. 2023 Feb 15;9(7):eadg2997. doi: 10.1126/sciadv.adg2997. Epub 2023 Feb 15. 10.1126/sciadv.adg2997 PubMed 36791199