Skip to main content

pCAG-GST-ATG101-W110D/F112D
(Plasmid #188106)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 188106 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAG
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ATG101
  • Alt name
    GST-TEV site-codon-optimized ATG101-W110D/F112D-stop
  • Species
    H. sapiens (human)
  • Mutation
    codon-optimized ATG101-W110D/F112D
  • Entrez Gene
    ATG101 (a.k.a. C12orf44)
  • Promoter CMV
  • Tag / Fusion Protein
    • GST tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (unknown if destroyed)
  • 3′ cloning site XmaI (unknown if destroyed)
  • 5′ sequencing primer ccgctttctggtatgccgtgcg
  • 3′ sequencing primer gagccagggcattggccacac
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-GST-ATG101-W110D/F112D was a gift from James Hurley (Addgene plasmid # 188106 ; http://n2t.net/addgene:188106 ; RRID:Addgene_188106)
  • For your References section:

    Structural basis for ATG9A recruitment to the ULK1 complex in mitophagy initiation. Ren X, Nguyen TN, Lam WK, Buffalo CZ, Lazarou M, Yokom AL, Hurley JH. Sci Adv. 2023 Feb 15;9(7):eadg2997. doi: 10.1126/sciadv.adg2997. Epub 2023 Feb 15. 10.1126/sciadv.adg2997 PubMed 36791199