pMXS-IRES-BLAST flag-CAD E1367A E1368A
(Plasmid
#188143)
-
PurposeExpresses C-terminal flag-tagged human CAD E1367A E1368A in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 188143 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMXS-IRES-BLAST
- Backbone size w/o insert (bp) 5623
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCAD
-
Alt namecarbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
-
SpeciesH. sapiens (human)
-
Insert Size (bp)6702
-
MutationTCC -> AGT silent mutations at nt439-441 eliminating PAM site for sgRNA target sequence 5'-ATTGGGGTCCAAGAATGGCA-3' and A -> C mutations at nt6022/6025 for Glu1367/Glu1368 -> Ala mutations of CAD
-
Entrez GeneCAD (a.k.a. CDG1Z, DEE50, EIEE50, GATD4)
-
Tag
/ Fusion Protein
- Flag tag (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGTAGACGGCATCGCAGCTTGGATA
- 3′ sequencing primer CGGAATTTACGTAGCGGCCGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMXS-IRES-BLAST flag-CAD E1367A E1368A was a gift from Richard Possemato (Addgene plasmid # 188143 ; http://n2t.net/addgene:188143 ; RRID:Addgene_188143) -
For your References section:
Allosteric regulation of CAD modulates de novo pyrimidine synthesis during the cell cycle. Shin J, Mir H, Khurram MA, Fujihara KM, Dynlacht BD, Cardozo TJ, Possemato R. Nat Metab. 2023 Feb 6. doi: 10.1038/s42255-023-00735-9. 10.1038/s42255-023-00735-9 PubMed 36747088