pTXTL-T7max-RLuc
(Plasmid
#188312)
-
PurposeExpression of Renilla luciferase via a T7 promoter in TXTL
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 188312 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCI-T7Max-UTR1-CTerminus8xHis-T500
-
Backbone manufacturerAdamala Lab
- Backbone size w/o insert (bp) 2918
-
Vector typeBacterial Expression, Luciferase, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRenilla luciferase
-
Alt nameR-Luc
-
Alt nameRLuc
-
SpeciesRenilla reniformis
-
Insert Size (bp)933
- Promoter T7Max
-
Tag
/ Fusion Protein
- 8x His-tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer AATAATTTTGTTTAACTTTAAGAAGGAGATATA
- 3′ sequencing primer GTTGTTGTACAGAAAAGCCCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byMichael Axtell Lab
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTXTL-T7max-RLuc was a gift from Kate Adamala (Addgene plasmid # 188312 ; http://n2t.net/addgene:188312 ; RRID:Addgene_188312) -
For your References section:
Expanding luciferase reporter systems for cell-free protein expression. Sato W, Rasmussen M, Deich C, Engelhart AE, Adamala KP. Sci Rep. 2022 Jul 7;12(1):11489. doi: 10.1038/s41598-022-15624-6. 10.1038/s41598-022-15624-6 PubMed 35798760