Skip to main content
Addgene

MG1655-OptoCre-cat-P-R
(Bacterial strain #188479)

Full plasmid sequence is not available for this item.

No maps are available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Bacterial Strain 188479 Bacteria in agar stab 1 $89

Backbone

  • Vector backbone
    E. coli K-12 MG1655
  • Modifications to backbone
    Cloning Method: Lambda Red (Datsenko-Wanner)

Growth in Bacteria

  • Bacterial Resistance(s)
    None
  • Growth Temperature
    37°C
  • Growth Strain(s)
    This is a strain.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    P-R-lox-TT-lox-cat

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GACTAACGGCTTCGGCTGTATC
  • 3′ sequencing primer GTGAAACGGTTGTACGGTTATGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MG1655-OptoCre-cat-P-R was a gift from Mary Dunlop (Addgene plasmid # 188479)
  • For your References section:

    An optogenetic toolkit for light-inducible antibiotic resistance. Sheets MB, Tague N, Dunlop MJ. Nat Commun. 2023 Feb 23;14(1):1034. doi: 10.1038/s41467-023-36670-2. 10.1038/s41467-023-36670-2 PubMed 36823420