Skip to main content

rtTA-sg-tdTomato90/816
(Plasmid #188487)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 188487 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PB_rtTA_BsmBI
  • Backbone manufacturer
    System Biosciences
  • Backbone size w/o insert (bp) 8652
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    tdTomato sgRNA
  • Alt name
    tandem dimer Tomato single guide RNA
  • gRNA/shRNA sequence
    ggccacgagttcgagatcga
  • Species
    Synthetic
  • Insert Size (bp)
    20
  • Mutation
    None
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer GAG GGC CTA TTT CCC ATG ATT
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid was cloned with the one step BsmBI restriction enzyme cloning method. Please note that gRNA sequences that do not start with a G, need a G added to the sequence before cloning for U6 promoter transcription.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    rtTA-sg-tdTomato90/816 was a gift from Indeever Madireddy & Johan Sosa (Addgene plasmid # 188487 ; http://n2t.net/addgene:188487 ; RRID:Addgene_188487)
  • For your References section:

    Stably Integrating an Inducible CRISPR-Cas9 to Protect Against Viral Infections in Vitro. Madireddy I, Pierson Smela M. MicroPubl Biol. 2022 Jun 16;2022. doi: 10.17912/micropub.biology.000590. eCollection 2022. 10.17912/micropub.biology.000590 PubMed 35789697