pMpGE_En03-gR082
(Plasmid
#188551)
-
PurposeGateway entry vector for sgRNA targeted to MpIGPD.Transient expression of sgRNA targeted to MpIGPD in Marchantia polymorpha.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 188551 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMpGE_En03
-
Vector typeCRISPR ; Entry Vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegR082
-
gRNA/shRNA sequencecttccctctgagaagacgatgtt
-
SpeciesM. polymorpha
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMpGE_En03-gR082 was a gift from Yutaka Kodama (Addgene plasmid # 188551 ; http://n2t.net/addgene:188551 ; RRID:Addgene_188551) -
For your References section:
Selection of a histidine auxotrophic Marchantia polymorpha strain with an auxotrophic selective marker. Fukushima T, Kodama Y. Plant Biotechnol (Tokyo). 2022 Dec 25;39(4):345-354. doi: 10.5511/plantbiotechnology.22.0810a. Epub 2022 Nov 26. 10.5511/plantbiotechnology.22.0810a PubMed 37283617