-
Purposecontrol probe of G-Flamp1, insensitive to cAMP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 188568 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCAG
- Backbone size w/o insert (bp) 6342
- Total vector size (bp) 7608
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameG-Flamp1-mut
-
SpeciesSynthetic
-
Insert Size (bp)1266
- Promoter CAG
-
Tag
/ Fusion Protein
- His tag
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer GCAACGTGCTGGTTATTGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.02.27.482140v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-G-Flamp1-mut was a gift from Jun Chu (Addgene plasmid # 188568 ; http://n2t.net/addgene:188568 ; RRID:Addgene_188568) -
For your References section:
A high-performance genetically encoded fluorescent indicator for in vivo cAMP imaging. Wang L, Wu C, Peng W, Zhou Z, Zeng J, Li X, Yang Y, Yu S, Zou Y, Huang M, Liu C, Chen Y, Li Y, Ti P, Liu W, Gao Y, Zheng W, Zhong H, Gao S, Lu Z, Ren PG, Ng HL, He J, Chen S, Xu M, Li Y, Chu J. Nat Commun. 2022 Sep 12;13(1):5363. doi: 10.1038/s41467-022-32994-7. 10.1038/s41467-022-32994-7 PubMed 36097007