lenti-ATAD2-plx303
(Plasmid
#188635)
-
PurposeATAD2 overexpression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 188635 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneplx303
-
Backbone manufacturerAddgene Plasmid# 25897
- Backbone size w/o insert (bp) 7715
- Total vector size (bp) 11889
-
Vector typeMammalian Expression, Bacterial Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameATAD2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4174
-
Entrez GeneATAD2 (a.k.a. ANCCA, CT137, PRO2000)
- Promoter CMV
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer caccatggtggttctccgcagcag
- 3′ sequencing primer TTatctggaacaactgaagttt (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene Plasmid# 65370
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lenti-ATAD2-plx303 was a gift from Lorenz Studer (Addgene plasmid # 188635 ; http://n2t.net/addgene:188635 ; RRID:Addgene_188635) -
For your References section:
Developmental chromatin programs determine oncogenic competence in melanoma. Baggiolini A, Callahan SJ, Montal E, Weiss JM, Trieu T, Tagore MM, Tischfield SE, Walsh RM, Suresh S, Fan Y, Campbell NR, Perlee SC, Saurat N, Hunter MV, Simon-Vermot T, Huang TH, Ma Y, Hollmann T, Tickoo SK, Taylor BS, Khurana E, Koche RP, Studer L, White RM. Science. 2021 Sep 3;373(6559):eabc1048. doi: 10.1126/science.abc1048. Epub 2021 Sep 3. 10.1126/science.abc1048 PubMed 34516843