mVenus-RapR-PTPPest
(Plasmid
#188657)
-
PurposeRapamycin regulated PTPPest with mVenus tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 188657 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepmVenus-C1
- Backbone size w/o insert (bp) 4693
- Total vector size (bp) 7314
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameProtein Tyrosine Phosphatase Pest
-
Alt namePTPPest
-
Alt namePTPN12
-
Insert Size (bp)2621
-
Entrez GenePTPN12 (a.k.a. PTP-PEST, PTPG1)
- Promoter CMV
-
Tag
/ Fusion Protein
- mVenus (N terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mVenus-RapR-PTPPest was a gift from Andrei Karginov (Addgene plasmid # 188657 ; http://n2t.net/addgene:188657 ; RRID:Addgene_188657) -
For your References section:
Dissecting protein tyrosine phosphatase signaling by engineered chemogenetic control of its activity. Fauser J, Huyot V, Matsche J, Szynal BN, Alexeev Y, Kota P, Karginov AV. J Cell Biol. 2022 Aug 1;221(8). pii: 213352. doi: 10.1083/jcb.202111066. Epub 2022 Jul 13. 10.1083/jcb.202111066 PubMed 35829702