FRB-GFP-Gab1(Y628F/Y660F)
(Plasmid
#188658)
-
PurposeFRB coupled to GFP tagged Gab1 with Shp2 binding sites mutated to Phe
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 188658 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEGFP-C1
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 7083
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGRB associated binding protein 1
-
Alt nameGab1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2108
-
MutationY628F and Y660F
-
Entrez GeneGab1 (a.k.a. AA408973, AW107238)
- Promoter CMV
-
Tags
/ Fusion Proteins
- GFP (N terminal on backbone)
- FRB (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FRB-GFP-Gab1(Y628F/Y660F) was a gift from Andrei Karginov (Addgene plasmid # 188658 ; http://n2t.net/addgene:188658 ; RRID:Addgene_188658) -
For your References section:
Dissecting protein tyrosine phosphatase signaling by engineered chemogenetic control of its activity. Fauser J, Huyot V, Matsche J, Szynal BN, Alexeev Y, Kota P, Karginov AV. J Cell Biol. 2022 Aug 1;221(8). pii: 213352. doi: 10.1083/jcb.202111066. Epub 2022 Jul 13. 10.1083/jcb.202111066 PubMed 35829702