Skip to main content

pMLS597
(Plasmid #188884)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 188884 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMLS134
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PU6(K09B11.12)::dpy-10 sgRNA
  • gRNA/shRNA sequence
    GGCTACCATAGGCACCACGAG
  • Species
    C. elegans (nematode)
  • Entrez Gene
    dpy-10 (a.k.a. CELE_T14B4.7)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMLS597 was a gift from Erik Jorgensen (Addgene plasmid # 188884 ; http://n2t.net/addgene:188884 ; RRID:Addgene_188884)
  • For your References section:

    High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. Schwartz ML, Davis MW, Rich MS, Jorgensen EM. PLoS Genet. 2021 Nov 8;17(11):e1009755. doi: 10.1371/journal.pgen.1009755. eCollection 2021 Nov. 10.1371/journal.pgen.1009755 PubMed 34748534