pMLS338
(Plasmid
#73719)
-
PurposeSapTrap Single plasmid targeting vector for tagging Unc-32 with GFP by CRISPR/Cas9
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73719 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMLS256
-
Vector typeWorm Expression, Cre/Lox, CRISPR
-
Selectable markersCbr-unc-119
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUnc-32::GFP(Cbr-unc-119)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer M13 (-21) Forward
- 3′ sequencing primer M13 Reverse (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
2nd Insert: pU6::Unc-32 sgRNA; oMLS471: 5' - TCCAAGAACTCGTACAAAAATGCTC
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMLS338 was a gift from Erik Jorgensen (Addgene plasmid # 73719 ; http://n2t.net/addgene:73719 ; RRID:Addgene_73719) -
For your References section:
SapTrap, a Toolkit for High-Throughput CRISPR/Cas9 Gene Modification in Caenorhabditis elegans. Schwartz ML, Jorgensen EM. Genetics. 2016 Feb 2. pii: genetics.115.184275. 10.1534/genetics.115.184275 PubMed 26837755